Stem-loop sequence hsa-mir-5006

AccessionMI0017873 (change log)
Symbol HGNC:MIR5006
DescriptionHomo sapiens miR-5006 stem-loop
Literature search

1 open access papers mention hsa-mir-5006
(1 sentences)

Stem-loop
   aaccau     --gg   u            ca     u         --cc    u 
5'       uaggg    cug gguuugccaggg  ggagg ggaagggag    ccau u
         |||||    ||| ||||||||||||  ||||| |||||||||    |||| a
3'       auuuc    gac ucggacgguccu  cuuuc ccuuuccuu    ggug c
   --gacc     aaga   u            ac     -         caau    a 
Get sequence
Deep sequencing
152 reads, 8.2 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 41568286-41568395 [-]
sense
OTTHUMT00000044654 ; ELF1-003; intron 1
OTTHUMT00000044653 ; ELF1-002; intron 1
ENST00000239882 ; ELF1-003; intron 1
ENST00000405737 ; ELF1-002; intron 1
Database links

Mature sequence hsa-miR-5006-5p

Accession MIMAT0021033
Sequence

21 - 

uugccagggcaggagguggaa

 - 41

Get sequence
Deep sequencing25 reads, 17 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-5006-3p

Accession MIMAT0021034
Sequence

70 - 

uuucccuuuccauccuggcag

 - 90

Get sequence
Deep sequencing114 reads, 49 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).