Stem-loop sequence hsa-mir-5004

AccessionMI0017870 (change log)
Symbol HGNC:MIR5004
DescriptionHomo sapiens miR-5004 stem-loop
Stem-loop
   -ggcacuugcuu       ag     -a     c       c a a ug g  gu 
5'             ggggguu  ugagg  caggg aaauuca g g u  g uu  g
               |||||||  |||||  ||||| ||||||| | | |  | ||   
3'             ccuucag  acucc  guccu uuuaggu c c a  c ga  c
   gguacagacuuu       -g     gg     -       u a - gu g  ga 
Get sequence
Deep sequencing
124 reads, 7.02 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 33438331-33438437 [+]
intergenic
Database links

Mature sequence hsa-miR-5004-5p

Accession MIMAT0021027
Sequence

21 - 

ugaggacagggcaaauucacga

 - 42

Get sequence
Deep sequencing28 reads, 18 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-5004-3p

Accession MIMAT0021028
Sequence

67 - 

cuuggauuuuccugggccucag

 - 88

Get sequence
Deep sequencing32 reads, 19 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).