Stem-loop sequence hsa-mir-5003

AccessionMI0017869 (change log)
Symbol HGNC:MIR5003
DescriptionHomo sapiens miR-5003 stem-loop
Stem-loop
   auga    g      g   u    a         u c       a  ug 
5'     guuu cuuugu uca ccuc caacaaccu g aggguag ga  a
       |||| |||||| ||| |||| ||||||||| | ||||||| ||  u
3'     caag gggacg ggu gggg guuguugga c uuucauc cu  u
   gaga    g      g   c    -         u u       -  uu 
Get sequence
Deep sequencing
74 reads, 12.5 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 172662165-172662263 [+]
antisense
OTTHUMT00000252942 ; NKX2-5-001; 5'UTR (exon 1)
OTTHUMT00000317804 ; NKX2-5-003; 5'UTR (exon 1)
OTTHUMT00000317805 ; NKX2-5-004; 5'UTR (exon 1)
OTTHUMT00000317803 ; NKX2-5-002; 5'UTR (exon 1)
ENST00000329198 ; NKX2-5-001; 5'UTR (exon 1)
ENST00000424406 ; NKX2-5-003; 5'UTR (exon 1)
ENST00000521848 ; NKX2-5-004; 5'UTR (exon 1)
ENST00000517440 ; NKX2-5-002; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-5003-5p

Accession MIMAT0021025
Sequence

23 - 

ucacaacaaccuugcaggguaga

 - 45

Get sequence
Deep sequencing12 reads, 9 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5003-3p

Accession MIMAT0021026
Sequence

58 - 

uacuuuucuagguuguugggg

 - 78

Get sequence
Deep sequencing44 reads, 25 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).