Stem-loop sequence hsa-mir-5002

AccessionMI0017868 (change log)
Symbol HGNC:MIR5002
DescriptionHomo sapiens miR-5002 stem-loop
Literature search

2 open access papers mention hsa-mir-5002
(3 sentences)

Stem-loop
   -ucuuc     ugucc       uu     uc       c     ag   a 
5'       cucuc     ucuggaa  ugguu  ugaggca uuagu  gug u
         |||||     |||||||  |||||  ||||||| |||||  |||  
3'       gggag     agaccuu  accag  acuccgu aguca  uac a
   cucauu     ----u       -c     uc       c     -g   g 
Get sequence
Deep sequencing
147 reads, 9.68 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 124132929-124133025 [+]
sense
OTTHUMT00000356381 ; KALRN-020; intron 4
OTTHUMT00000259128 ; KALRN-008; intron 4
OTTHUMT00000258842 ; KALRN-004; intron 13
OTTHUMT00000356282 ; KALRN-013; intron 14
OTTHUMT00000258843 ; KALRN-005; intron 14
ENST00000484224 ; KALRN-020; intron 4
ENST00000393501 ; KALRN-008; intron 4
ENST00000354186 ; KALRN-004; intron 13
ENST00000460856 ; KALRN-013; intron 14
ENST00000240874 ; KALRN-005; intron 14
ENST00000360013 ; KALRN-201; intron 14
Database links

Mature sequence hsa-miR-5002-5p

Accession MIMAT0021023
Sequence

21 - 

aauuugguuucugaggcacuuagu

 - 44

Get sequence
Deep sequencing98 reads, 47 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5002-3p

Accession MIMAT0021024
Sequence

60 - 

ugacugccucacugaccacuu

 - 80

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).