Stem-loop sequence hsa-mir-5000

AccessionMI0017866 (change log)
Symbol HGNC:MIR5000
DescriptionHomo sapiens miR-5000 stem-loop
Stem-loop
   cugaa     --   ---          c             u       aacuug 
5'      gagua  gag   uguguggucc aguucagaagugu ccugagu      u
        |||||  |||   |||||||||| ||||||||||||| |||||||       
3'      uucgu  cuc   acauaccagg ucaagucuucaca ggacuca      g
   -----     cc   ugg          u             -       auauuc 
Get sequence
Deep sequencing
409 reads, 11.8 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 75090812-75090914 [+]
sense
OTTHUMT00000328638 ; HK2-003; intron 1
OTTHUMT00000252238 ; HK2-001; intron 2
OTTHUMT00000328629 ; HK2-002; intron 2
ENST00000472302 ; HK2-003; intron 1
ENST00000290573 ; HK2-001; intron 2
ENST00000409174 ; HK2-002; intron 2
Database links

Mature sequence hsa-miR-5000-5p

Accession MIMAT0021019
Sequence

24 - 

caguucagaaguguuccugagu

 - 45

Get sequence
Deep sequencing98 reads, 24 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-5000-3p

Accession MIMAT0021020
Sequence

62 - 

ucaggacacuucugaacuugga

 - 83

Get sequence
Deep sequencing303 reads, 85 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).