Stem-loop sequence hsa-mir-4999

AccessionMI0017865 (change log)
Symbol HGNC:MIR4999
DescriptionHomo sapiens miR-4999 stem-loop
Literature search

1 open access papers mention hsa-mir-4999
(1 sentences)

Stem-loop
   auagaaa        c    -                          
5'        auaaaaca auac ugcuguauugucagguagugauagg 
          |||||||| |||| |||||||||||||||||||||||| a
3'        uauuuugu ugug augacauaacaguccaucacuauuu 
   -uuuaua        u    u                          
Get sequence
Deep sequencing
426 reads, 13.6 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 8389290-8389380 [-]
sense
OTTHUMT00000461378 ; KANK3-001; intron 10
OTTHUMT00000461379 ; KANK3-002; intron 10
ENST00000330915 ; KANK3-001; intron 10
ENST00000593649 ; KANK3-002; intron 10
Database links

Mature sequence hsa-miR-4999-5p

Accession MIMAT0021017
Sequence

21 - 

ugcuguauugucagguaguga

 - 41

Get sequence
Deep sequencing378 reads, 97 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-4999-3p

Accession MIMAT0021018
Sequence

51 - 

ucacuaccugacaauacagu

 - 70

Get sequence
Deep sequencing38 reads, 25 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).