Stem-loop sequence hsa-mir-486-1

AccessionMI0002470 (change log)
Previous IDshsa-mir-486
Symbol HGNC:MIR486-1
DescriptionHomo sapiens miR-486 stem-loop
Gene family MIPF0000220; mir-486
Literature search

182 open access papers mention hsa-mir-486-1
(1080 sentences)

Stem-loop
   gc                      ----   ccuu 
5'   auccuguacugagcugccccga    ggc    c
     ||||||||||||||||||||||    |||     
3'   uaggacaugacucgacggggcu    ccg    a
   ca                      cgac   ucgu 
Get sequence
Deep sequencing
187898 reads, 651 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 41660441-41660508 [-]
sense
OTTHUMT00000377171 ; ANK1-006; intron 1
ENST00000265709 ; ANK1-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-486-1
hsa-mir-486-2chr8: 41660444-41660507 [+]
hsa-mir-486-1chr8: 41660441-41660508 [-]
Database links

Mature sequence hsa-miR-486-5p

Accession MIMAT0002177
Previous IDshsa-miR-486
Sequence

4 - 

uccuguacugagcugccccgag

 - 25

Get sequence
Deep sequencing361964 reads, 153 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-486-3p

Accession MIMAT0004762
Sequence

46 - 

cggggcagcucaguacaggau

 - 66

Get sequence
Deep sequencing11736 reads, 104 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).