Stem-loop sequence hsa-mir-4802

AccessionMI0017450 (change log)
Symbol HGNC:MIR4802
DescriptionHomo sapiens miR-4802 stem-loop
Literature search

1 open access papers mention hsa-mir-4802
(1 sentences)

Stem-loop
      ac        a        -   ga      u  ugu 
5' cug  uggcuugu uggagguu cua  ccaugu ag   u
   |||  |||||||| |||||||| |||  |||||| ||   c
3' gac  accggacg acuuccaa ggu  gguaca uc   a
      ga        a        a   -a      -  uga 
Get sequence
Deep sequencing
596 reads, 0 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 40502040-40502119 [-]
sense
OTTHUMT00000250456 ; RBM47-001; intron 1
OTTHUMT00000250457 ; RBM47-002; intron 1
OTTHUMT00000362038 ; RBM47-015; intron 1
OTTHUMT00000362035 ; RBM47-012; intron 1
OTTHUMT00000362030 ; RBM47-007; intron 2
OTTHUMT00000362029 ; RBM47-006; intron 2
OTTHUMT00000362028 ; RBM47-005; intron 2
OTTHUMT00000362034 ; RBM47-011; intron 2
OTTHUMT00000362032 ; RBM47-009; intron 2
OTTHUMT00000362036 ; RBM47-013; intron 2
OTTHUMT00000362033 ; RBM47-010; intron 2
OTTHUMT00000362031 ; RBM47-008; intron 3
ENST00000381793 ; RBM47-001; intron 1
ENST00000381795 ; RBM47-002; intron 1
ENST00000513473 ; RBM47-015; intron 1
ENST00000511902 ; RBM47-012; intron 1
ENST00000510871 ; RBM47-007; intron 2
ENST00000295971 ; RBM47-006; intron 2
ENST00000514014 ; RBM47-005; intron 2
ENST00000515053 ; RBM47-011; intron 2
ENST00000505414 ; RBM47-009; intron 2
ENST00000514782 ; RBM47-013; intron 2
ENST00000505220 ; RBM47-010; intron 2
ENST00000319592 ; RBM47-201; intron 2
ENST00000511598 ; RBM47-008; intron 3
Database links

Mature sequence hsa-miR-4802-5p

Accession MIMAT0019981
Sequence

13 - 

uauggagguucuagaccauguu

 - 34

Get sequence
Deep sequencing272 reads, 62 experiments
Evidence experimental; Illumina [1,3]
Predicted targets

Mature sequence hsa-miR-4802-3p

Accession MIMAT0019982
Sequence

47 - 

uacauggauggaaaccuucaagc

 - 69

Get sequence
Deep sequencing320 reads, 48 experiments
Evidence experimental; Illumina [1,3]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).