Stem-loop sequence hsa-mir-4801

AccessionMI0017449 (change log)
Symbol HGNC:MIR4801
DescriptionHomo sapiens miR-4801 stem-loop
Stem-loop
   u    g           ua        a   -aau     u 
5'  ugag cuugguuuucu  uguguaaa ugu    aacau u
    |||| |||||||||||  |||||||| |||    ||||| c
3'  acuc gaaccaaaaga  acacauuu aca    uugua u
   a    g           --        c   aaau     u 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 37241910-37241991 [-]
intergenic
Database links

Mature sequence hsa-miR-4801

Accession MIMAT0019980
Sequence

60 - 

uacacaagaaaaccaaggcuca

 - 81

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).