Stem-loop sequence hsa-mir-4800

AccessionMI0017448 (change log)
Symbol HGNC:MIR4800
DescriptionHomo sapiens miR-4800 stem-loop
Stem-loop
      --  a   --a      c  -   a   a   -     a 
5' gga  ga agg   guggac ga gga gga gga aggca g
   |||  || |||   |||||| || ||| ||| ||| |||||  
3' ccu  cu ucc   caccug cu ccu ccu ccu ucugu g
      ga  g   auc      u  g   g   a   g     c 
Get sequence
Deep sequencing
339 reads, 4.26 reads per million, 94 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 2250077-2250156 [-]
sense
OTTHUMT00000206519 ; MXD4-001; 3'UTR (exon 6)
ENST00000337190 ; MXD4-001; 3'UTR (exon 6)
Database links

Mature sequence hsa-miR-4800-5p

Accession MIMAT0019978
Sequence

10 - 

aguggaccgaggaaggaagga

 - 30

Get sequence
Deep sequencing130 reads, 47 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4800-3p

Accession MIMAT0019979
Sequence

48 - 

cauccguccgucuguccac

 - 66

Get sequence
Deep sequencing189 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).