Stem-loop sequence hsa-mir-4799

AccessionMI0017446 (change log)
Symbol HGNC:MIR4799
DescriptionHomo sapiens miR-4799 stem-loop
Stem-loop
              c                     gag 
5' acugcuaauau uaaaugcagcaugccaguccu   a
   ||||||||||| |||||||||||||||||||||    
3' ugacgauuaua auuuacgucguacggucaggg   u
              u                     acg 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 147782595-147782668 [+]
antisense
OTTHUMT00000367025 ; TTC29-003; intron 8
OTTHUMT00000367024 ; TTC29-002; intron 8
OTTHUMT00000367023 ; TTC29-001; intron 9
ENST00000398886 ; TTC29-202; intron 7
ENST00000508306 ; TTC29-003; intron 8
ENST00000504425 ; TTC29-002; intron 8
ENST00000325106 ; TTC29-201; intron 8
ENST00000513335 ; TTC29-001; intron 9
Database links

Mature sequence hsa-miR-4799-5p

Accession MIMAT0019976
Sequence

10 - 

aucuaaaugcagcaugccaguc

 - 31

Get sequence
Deep sequencing50 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4799-3p

Accession MIMAT0019977
Sequence

45 - 

acuggcaugcugcauuuauaua

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).