Stem-loop sequence hsa-mir-4798

AccessionMI0017445 (change log)
Symbol HGNC:MIR4798
DescriptionHomo sapiens miR-4798 stem-loop
Gene family MIPF0001574; mir-4798
Stem-loop
        ca                   a    -    u 
5' aagua  acuucgguauacuuuguga uugg cuuu a
   |||||  ||||||||||||||||||| |||| ||||  
3' uucau  ugaagccauaugaagcacu aacc gaaa c
        ac                   c    a    a 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 7310450-7310524 [+]
sense
OTTHUMT00000358685 ; SORCS2-001; intron 1
ENST00000507866 ; SORCS2-001; intron 1
Database links

Mature sequence hsa-miR-4798-5p

Accession MIMAT0019974
Sequence

10 - 

uucgguauacuuugugaauugg

 - 31

Get sequence
Deep sequencing100 reads, 53 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4798-3p

Accession MIMAT0019975
Sequence

47 - 

aacucacgaaguauaccgaagu

 - 68

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).