Stem-loop sequence hsa-mir-4797

AccessionMI0017444 (change log)
Symbol HGNC:MIR4797
DescriptionHomo sapiens miR-4797 stem-loop
Literature search

1 open access papers mention hsa-mir-4797
(2 sentences)

Stem-loop
                                a   u 
5' gacucagaagacagagugccacuuacuga agg u
   ||||||||||||||||||||||||||||| ||| u
3' uugagucuucugucucacggugaaugacu ucu u
                                c   u 
Get sequence
Deep sequencing
223 reads, 0 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 197293878-197293948 [-]
sense
OTTHUMT00000340282 ; BDH1-016; intron 1
ENST00000431056 ; BDH1-016; intron 1
ENST00000358186 ; BDH1-201; intron 1
Database links

Mature sequence hsa-miR-4797-5p

Accession MIMAT0019972
Sequence

10 - 

gacagagugccacuuacugaa

 - 30

Get sequence
Deep sequencing42 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4797-3p

Accession MIMAT0019973
Sequence

41 - 

ucucaguaaguggcacucugu

 - 61

Get sequence
Deep sequencing131 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).