Stem-loop sequence hsa-mir-4796

AccessionMI0017443 (change log)
Symbol HGNC:MIR4796
DescriptionHomo sapiens miR-4796 stem-loop
Gene family MIPF0001402; mir-4796
Stem-loop
                                  --uu    c 
5' uaaauuugugucuauacucugucacuuuacu    uggc u
   |||||||||||||||||||||||||||||||    |||| c
3' auuuaaacacagauaugagacggugaaauga    acug a
                                  cguu    a 
Get sequence
Deep sequencing
212 reads, 0 reads per million, 83 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 114743445-114743525 [-]
sense
OTTHUMT00000354954 ; ZBTB20-006; intron 1
OTTHUMT00000354953 ; ZBTB20-005; intron 1
OTTHUMT00000354961 ; ZBTB20-013; intron 1
OTTHUMT00000354956 ; ZBTB20-008; intron 1
OTTHUMT00000354958 ; ZBTB20-010; intron 1
OTTHUMT00000354960 ; ZBTB20-012; intron 2
ENST00000462705 ; ZBTB20-006; intron 1
ENST00000357258 ; ZBTB20-005; intron 1
ENST00000463890 ; ZBTB20-013; intron 1
ENST00000492665 ; ZBTB20-008; intron 1
ENST00000488663 ; ZBTB20-010; intron 1
ENST00000470186 ; ZBTB20-012; intron 2
Database links

Mature sequence hsa-miR-4796-5p

Accession MIMAT0019970
Sequence

9 - 

ugucuauacucugucacuuuac

 - 30

Get sequence
Deep sequencing70 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4796-3p

Accession MIMAT0019971
Sequence

53 - 

uaaaguggcagaguauagacac

 - 74

Get sequence
Deep sequencing137 reads, 63 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).