Stem-loop sequence hsa-mir-4795

AccessionMI0017442 (change log)
Symbol HGNC:MIR4795
DescriptionHomo sapiens miR-4795 stem-loop
Literature search

1 open access papers mention hsa-mir-4795
(1 sentences)

Stem-loop
   u   auggaag                             c   a 
5'  gau       aaauccagaaguggcuaauaauauugaca uau a
    |||       ||||||||||||||||||||||||||||| |||  
3'  cua       uuuaggucuucaccgauuauuauaacugu aua c
   a   ---agua                             a   a 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 87226189-87226277 [-]
intergenic
Database links

Mature sequence hsa-miR-4795-5p

Accession MIMAT0019968
Sequence

18 - 

agaaguggcuaauaauauuga

 - 38

Get sequence
Deep sequencing22 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4795-3p

Accession MIMAT0019969
Sequence

58 - 

auauuauuagccacuucuggau

 - 79

Get sequence
Deep sequencing92 reads, 54 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).