Stem-loop sequence hsa-mir-4794

AccessionMI0017441 (change log)
Symbol HGNC:MIR4794
DescriptionHomo sapiens miR-4794 stem-loop
Stem-loop
   u                    c         u uc u 
5'  uuuaacaucuggcuaucuca gagacugua g  c a
    |||||||||||||||||||| ||||||||| |  | a
3'  aaauuguagaccgauagagu cucugaugu c  g c
   a                    a         u gu a 
Get sequence
Deep sequencing
45 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 64579847-64579923 [+]
sense
OTTHUMT00000025003 ; ROR1-002; intron 4
OTTHUMT00000025002 ; ROR1-001; intron 4
OTTHUMT00000025004 ; ROR1-003; intron 4
ENST00000371080 ; ROR1-002; intron 4
ENST00000371079 ; ROR1-001; intron 4
ENST00000482426 ; ROR1-003; intron 4
antisense
OTTHUMT00000025008 ; RP11-24J23.2-001; intron 1
ENST00000424995 ; RP11-24J23.2-001; intron 1
Database links

Mature sequence hsa-miR-4794

Accession MIMAT0019967
Sequence

9 - 

ucuggcuaucucacgagacugu

 - 30

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).