Stem-loop sequence hsa-mir-4793

AccessionMI0017440 (change log)
Symbol HGNC:MIR4793
DescriptionHomo sapiens miR-4793 stem-loop
Literature search

1 open access papers mention hsa-mir-4793
(6 sentences)

Stem-loop
   uuuc     g u   c  a  uccu    c    g       gaggc 
5'     uccuc c gcc gc ca    gcuc acag gcagagg     c
       ||||| | ||| || ||    |||| |||| |||||||     a
3'     aggag g cgg cg gu    ugag uguc cgucucc     a
   ---a     - u   u  -  ----    -    a       agaag 
Get sequence
Deep sequencing
81 reads, 8.57 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 48644194-48644280 [-]
sense
OTTHUMT00000344981 ; UQCRC1-004; intron 1
OTTHUMT00000257517 ; UQCRC1-001; intron 2
OTTHUMT00000345035 ; UQCRC1-010; intron 2
OTTHUMT00000344982 ; UQCRC1-005; intron 2
OTTHUMT00000345033 ; UQCRC1-008; intron 2
ENST00000415995 ; UQCRC1-004; intron 1
ENST00000203407 ; UQCRC1-001; intron 2
ENST00000412343 ; UQCRC1-010; intron 2
ENST00000467690 ; UQCRC1-005; intron 2
ENST00000463708 ; UQCRC1-008; intron 2
Database links

Mature sequence hsa-miR-4793-5p

Accession MIMAT0019965
Sequence

19 - 

acauccugcuccacagggcagagg

 - 42

Get sequence
Deep sequencing29 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4793-3p

Accession MIMAT0019966
Sequence

58 - 

ucugcacugugaguuggcuggcu

 - 80

Get sequence
Deep sequencing36 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).