Stem-loop sequence hsa-mir-4790

AccessionMI0017437 (change log)
Symbol HGNC:MIR4790
DescriptionHomo sapiens miR-4790 stem-loop
Literature search

1 open access papers mention hsa-mir-4790
(1 sentences)

Stem-loop
                                cac     gg 
5' caaugugacaucgcuuuaccauucauguu   ugaaa  u
   |||||||||||||||||||||||||||||   |||||   
3' guuacacuguagcgaaaugguaaguacaa   auuuu  a
                                -aa     ag 
Get sequence
Deep sequencing
25 reads, 52.9 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 5250177-5250255 [-]
antisense
OTTHUMT00000337566 ; EDEM1-001; intron 8
OTTHUMT00000337567 ; EDEM1-002; intron 8
OTTHUMT00000337568 ; EDEM1-003; intron 8
ENST00000256497 ; EDEM1-001; intron 8
ENST00000465369 ; EDEM1-002; intron 8
ENST00000445686 ; EDEM1-003; intron 8
Database links

Mature sequence hsa-miR-4790-5p

Accession MIMAT0019961
Sequence

10 - 

aucgcuuuaccauucauguu

 - 29

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4790-3p

Accession MIMAT0019962
Sequence

55 - 

ugaaugguaaagcgaugucaca

 - 76

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).