Stem-loop sequence hsa-mir-4789

AccessionMI0017436 (change log)
Symbol HGNC:MIR4789
DescriptionHomo sapiens miR-4789 stem-loop
Stem-loop
     u     g              a       ----      a 
5' ca gcuac uauguauacaccug uaugugu    augugu a
   || ||||| |||||||||||||| |||||||    ||||||  
3' gu cgaug auauauauguggac auacaca    uauaca a
     c     g              g       cacc      u 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 175369540-175369621 [+]
sense
OTTHUMT00000347392 ; NAALADL2-003; intron 10
OTTHUMT00000347390 ; NAALADL2-001; intron 11
ENST00000489299 ; NAALADL2-003; intron 10
ENST00000454872 ; NAALADL2-001; intron 11
Database links

Mature sequence hsa-miR-4789-5p

Accession MIMAT0019959
Sequence

13 - 

guauacaccugauauguguaug

 - 34

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4789-3p

Accession MIMAT0019960
Sequence

51 - 

cacacauagcagguguauaua

 - 71

Get sequence
Deep sequencing68 reads, 37 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).