Stem-loop sequence hsa-mir-4788

AccessionMI0017435 (change log)
Symbol HGNC:MIR4788
DescriptionHomo sapiens miR-4788 stem-loop
Gene family MIPF0001573; mir-4788
Literature search

1 open access papers mention hsa-mir-4788
(1 sentences)

Stem-loop
               c                   uu     c 
5' aaugaaggauua ggaccagcuaagggaggca  aggau c
   |||||||||||| |||||||||||||||||||  |||||  
3' uugcuuccuaau ccugguugauucccuccgu  ucuua u
               c                   --     u 
Get sequence
Deep sequencing
33 reads, 4.35 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 134437827-134437906 [+]
sense
OTTHUMT00000357425 ; EPHB1-004; intron 1
OTTHUMT00000357424 ; EPHB1-003; intron 2
ENST00000460895 ; EPHB1-004; intron 1
ENST00000467708 ; EPHB1-003; intron 2
Database links

Mature sequence hsa-miR-4788

Accession MIMAT0019958
Sequence

10 - 

uuacggaccagcuaagggaggc

 - 31

Get sequence
Deep sequencing31 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).