Stem-loop sequence hsa-mir-4786

AccessionMI0017433 (change log)
Symbol HGNC:MIR4786
DescriptionHomo sapiens miR-4786 stem-loop
Stem-loop
   -g  c       g       ga    aug    a -  uc 
5'   gg auggccu agaccag  cugg   cacc c uc  c
     || ||||||| |||||||  ||||   |||| | ||  c
3'   cu uaccggg ucugguc  gacc   gugg g ag  u
   ca  u       -       uc    gaa    a u  ug 
Get sequence
Deep sequencing
310 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 239943015-239943094 [-]
intergenic
Database links

Mature sequence hsa-miR-4786-5p

Accession MIMAT0019954
Sequence

11 - 

ugagaccaggacuggaugcacc

 - 32

Get sequence
Deep sequencing159 reads, 59 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4786-3p

Accession MIMAT0019955
Sequence

51 - 

ugaagccagcucuggucugggc

 - 72

Get sequence
Deep sequencing144 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).