Stem-loop sequence hsa-mir-4784

AccessionMI0017429 (change log)
Symbol HGNC:MIR4784
DescriptionHomo sapiens miR-4784 stem-loop
Stem-loop
   u   -  g cu     gau  u     u   a  gu a 
5'  gac ug g  gagga   gc gggac gag gu  c u
    ||| || |  |||||   || ||||| ||| ||  | g
3'  uug ac c  cuccu   cg cccug cuc cg  g g
   g   u  g cu     acu  u     c   -  ag u 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 131491160-131491236 [-]
intergenic
Database links

Mature sequence hsa-miR-4784

Accession MIMAT0019948
Sequence

10 - 

ugaggagaugcugggacuga

 - 29

Get sequence
Deep sequencing48 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).