Stem-loop sequence hsa-mir-4783

AccessionMI0017428 (change log)
Symbol HGNC:MIR4783
DescriptionHomo sapiens miR-4783 stem-loop
Stem-loop
      aa     a          -   u  c     g    cg 
5' ggg  agcgg gggcgcgccc agc cc gggcu auug  c
   |||  ||||| |||||||||| ||| || ||||| ||||   
3' ccc  ucgcc ucugcgcggg uug gg cccgg ugac  u
      cg     g          g   u  c     -    aa 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 127423537-127423618 [-]
antisense
OTTHUMT00000254297 ; GYPC-001; intron 1
OTTHUMT00000330928 ; GYPC-005; intron 1
OTTHUMT00000330925 ; GYPC-002; intron 1
OTTHUMT00000330926 ; GYPC-003; intron 1
ENST00000259254 ; GYPC-001; intron 1
ENST00000459787 ; GYPC-005; intron 1
ENST00000409836 ; GYPC-002; intron 1
ENST00000464053 ; GYPC-003; intron 1
ENST00000356887 ; GYPC-201; intron 1
Database links

Mature sequence hsa-miR-4783-5p

Accession MIMAT0019946
Sequence

13 - 

ggcgcgcccagcucccgggcu

 - 33

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4783-3p

Accession MIMAT0019947
Sequence

51 - 

ccccgguguuggggcgcgucugc

 - 73

Get sequence
Deep sequencing75 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).