Stem-loop sequence hsa-mir-4782

AccessionMI0017427 (change log)
Symbol HGNC:MIR4782
DescriptionHomo sapiens miR-4782 stem-loop
Gene family MIPF0001546; mir-4782
Literature search

1 open access papers mention hsa-mir-4782
(1 sentences)

Stem-loop
                                     aaga 
5' auugcccaguucuggauaugaagacaaucaagaa    u
   ||||||||||||||||||||||||||||||||||    u
3' ugacgggucaagaucuauacuucuguuaguucuu    u
                                     gugg 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 113721290-113721368 [-]
intergenic
Database links

Mature sequence hsa-miR-4782-5p

Accession MIMAT0019944
Sequence

10 - 

uucuggauaugaagacaaucaa

 - 31

Get sequence
Deep sequencing35 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4782-3p

Accession MIMAT0019945
Sequence

50 - 

ugauugucuucauaucuagaac

 - 71

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).