Stem-loop sequence hsa-mir-4781

AccessionMI0017426 (change log)
Symbol HGNC:MIR4781
DescriptionHomo sapiens miR-4781 stem-loop
Stem-loop
                                     cca 
5' aggugcacgcucuagcggggauuccaauauuggg   a
   ||||||||||||||||||||||||||||||||||    
3' uucacgugcgagaucgcuccuaagguuguaaccc   u
                                     ccu 
Get sequence
Deep sequencing
238 reads, 0 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 54054079-54054154 [+]
antisense
OTTHUMT00000022109 ; GLIS1-001; intron 3
ENST00000312233 ; GLIS1-001; intron 3
Database links

Mature sequence hsa-miR-4781-5p

Accession MIMAT0019942
Sequence

13 - 

uagcggggauuccaauauugg

 - 33

Get sequence
Deep sequencing34 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4781-3p

Accession MIMAT0019943
Sequence

46 - 

aauguuggaauccucgcuagag

 - 67

Get sequence
Deep sequencing203 reads, 78 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).