Stem-loop sequence hsa-mir-4780

AccessionMI0017424 (change log)
Symbol HGNC:MIR4780
DescriptionHomo sapiens miR-4780 stem-loop
Stem-loop
   -- gc      ca                 ac   c  aaa 
5'   g  cagugc  gggggucaggcucaagg  cag cc   g
     |  ||||||  |||||||||||||||||  ||| ||    
3'   c  gucacg  ucccuaguccgaguucc  guc gg   g
   cc ua      -a                 ca   c  acc 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 88082519-88082599 [-]
sense
OTTHUMT00000330534 ; RGPD2-001; exon 20
ENST00000398146 ; RGPD2-001; exon 20
ENST00000420840 ; RGPD2-202; exon 20
ENST00000327544 ; RGPD2-201; exon 20
Database links

Mature sequence hsa-miR-4780

Accession MIMAT0019939
Sequence

51 - 

acccuugagccugaucccuagc

 - 72

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).