Stem-loop sequence hsa-mir-4779

AccessionMI0017423 (change log)
Symbol HGNC:MIR4779
DescriptionHomo sapiens miR-4779 stem-loop
Literature search

1 open access papers mention hsa-mir-4779
(121 sentences)

Stem-loop
                                        cca 
5' uaaaugucuuacugcuuuuacuguucccuccuagagu   u
   |||||||||||||||||||||||||||||||||||||   u
3' auuuacagaaugacgaaaaugauaagggaggaucuca   c
                                        uuu 
Get sequence
Deep sequencing
95 reads, 11.1 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 86193026-86193108 [-]
intergenic
Database links

Mature sequence hsa-miR-4779

Accession MIMAT0019938
Sequence

51 - 

uaggagggaauaguaaaagcag

 - 72

Get sequence
Deep sequencing72 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).