Stem-loop sequence hsa-mir-4778

AccessionMI0017422 (change log)
Symbol HGNC:MIR4778
DescriptionHomo sapiens miR-4778 stem-loop
Stem-loop
   u       c                       uaagaag 
5'  cacaugu caauucuguaaaggaagaagagg       a
    ||||||| |||||||||||||||||||||||        
3'  guguaua guugagacguuuccuucuucucc       a
   g       a                       cgaagug 
Get sequence
Deep sequencing
864 reads, 2.27 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 66358249-66358328 [-]
intergenic
Database links

Mature sequence hsa-miR-4778-5p

Accession MIMAT0019936
Sequence

11 - 

aauucuguaaaggaagaagagg

 - 32

Get sequence
Deep sequencing374 reads, 31 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4778-3p

Accession MIMAT0019937
Sequence

51 - 

ucuucuuccuuugcagaguuga

 - 72

Get sequence
Deep sequencing478 reads, 28 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).