Stem-loop sequence hsa-mir-4777

AccessionMI0017421 (change log)
Symbol HGNC:MIR4777
DescriptionHomo sapiens miR-4777 stem-loop
Literature search

1 open access papers mention hsa-mir-4777
(1 sentences)

Stem-loop
            u                ag    a       cu 
5' uagaauauu cggcauucuagaugag  auau uauauac  c
   ||||||||| ||||||||||||||||  |||| |||||||  a
3' aucuuauaa gucguaagaucuacuc  uaug guauaug  u
            u                ca    -       ua 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 231362708-231362793 [+]
sense
OTTHUMT00000332263 ; SP100-019; intron 4
OTTHUMT00000256914 ; SP100-001; intron 18
OTTHUMT00000332248 ; SP100-004; intron 18
OTTHUMT00000332246 ; SP100-002; intron 18
ENST00000492546 ; SP100-019; intron 4
ENST00000264052 ; SP100-001; intron 18
ENST00000409112 ; SP100-004; intron 18
ENST00000340126 ; SP100-002; intron 18
Database links

Mature sequence hsa-miR-4777-5p

Accession MIMAT0019934
Sequence

16 - 

uucuagaugagagauauauaua

 - 37

Get sequence
Deep sequencing14 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4777-3p

Accession MIMAT0019935
Sequence

57 - 

auaccucaucuagaaugcugua

 - 78

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).