Stem-loop sequence hsa-mir-4776-1

AccessionMI0017419 (change log)
Symbol HGNC:MIR4776-1
DescriptionHomo sapiens miR-4776-1 stem-loop
Gene family MIPF0001210; mir-4776
Stem-loop
                                    c   aa 
5' cuauaugcaguggaccaggauggcaagggcucu cug  a
   ||||||||||||||||||||||||||||||||| |||   
3' gauauacgucaccugguccuaccguucccgaga gac  g
                                    u   ag 
Get sequence
Deep sequencing
61 reads, 8.33 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 212926257-212926336 [+]
antisense
OTTHUMT00000256597 ; ERBB4-001; intron 2
OTTHUMT00000336976 ; ERBB4-002; intron 2
OTTHUMT00000336977 ; ERBB4-003; intron 2
OTTHUMT00000336978 ; ERBB4-004; intron 2
OTTHUMT00000336979 ; ERBB4-005; intron 2
ENST00000342788 ; ERBB4-001; intron 2
ENST00000436443 ; ERBB4-002; intron 2
ENST00000484594 ; ERBB4-003; intron 2
ENST00000260943 ; ERBB4-004; intron 2
ENST00000435846 ; ERBB4-005; intron 2
ENST00000402597 ; ERBB4-201; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4776-1
hsa-mir-4776-2chr2: 212926257-212926336 [-]
hsa-mir-4776-1chr2: 212926257-212926336 [+]
Database links

Mature sequence hsa-miR-4776-5p

Accession MIMAT0019932
Sequence

10 - 

guggaccaggauggcaagggcu

 - 31

Get sequence
Deep sequencing98 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4776-3p

Accession MIMAT0019933
Sequence

54 - 

cuugccauccugguccacugcau

 - 76

Get sequence
Deep sequencing18 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).