Stem-loop sequence hsa-mir-4775

AccessionMI0017418 (change log)
Symbol HGNC:MIR4775
DescriptionHomo sapiens miR-4775 stem-loop
Literature search

1 open access papers mention hsa-mir-4775
(4 sentences)

Stem-loop
   auu                          --c   ug 
5'    aagcuuuuaauuuuuuguuucgguca   ucu  a
      ||||||||||||||||||||||||||   |||  u
3'    uucgaaaauuaaaaaacaaagucagu   aga  a
   uau                          uac   cg 
Get sequence
Deep sequencing
144 reads, 0 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 207754807-207754881 [+]
intergenic
Database links

Mature sequence hsa-miR-4775

Accession MIMAT0019931
Sequence

10 - 

uuaauuuuuuguuucggucacu

 - 31

Get sequence
Deep sequencing109 reads, 64 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).