Stem-loop sequence hsa-mir-4774

AccessionMI0017417 (change log)
Symbol HGNC:MIR4774
DescriptionHomo sapiens miR-4774 stem-loop
Gene family MIPF0001578; mir-4774
Literature search

1 open access papers mention hsa-mir-4774
(1 sentences)

Stem-loop
   uaua     g          ag        -aa   a 
5'     uuguu ucugguaugu  uagguaau   cug c
       ||||| ||||||||||  ||||||||   ||| a
3'     aacaa agaccgugua  auccguua   gac a
   auac     a          ca        aca   a 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 168582943-168583018 [+]
intergenic
Database links

Mature sequence hsa-miR-4774-5p

Accession MIMAT0019929
Sequence

11 - 

ucugguauguaguagguaauaa

 - 32

Get sequence
Deep sequencing57 reads, 26 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-4774-3p

Accession MIMAT0019930
Sequence

47 - 

auugccuaacaugugccagaa

 - 67

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).