Stem-loop sequence hsa-mir-4772

AccessionMI0017414 (change log)
Symbol HGNC:MIR4772
DescriptionHomo sapiens miR-4772 stem-loop
Literature search

1 open access papers mention hsa-mir-4772
(35 sentences)

Stem-loop
                          a      a    cuu 
5' gugauugccucugaucaggcaaa uugcag cugu   c
   ||||||||||||||||||||||| |||||| ||||    
3' cacugacggagacuaguccguuu aacguc gaua   c
                          c      c    aac 
Get sequence
Deep sequencing
201 reads, 1.59 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 102432289-102432366 [+]
sense
OTTHUMT00000339998 ; MAP4K4-009; intron 1
OTTHUMT00000339993 ; MAP4K4-004; intron 2
OTTHUMT00000339838 ; MAP4K4-002; intron 3
OTTHUMT00000339992 ; MAP4K4-003; intron 3
OTTHUMT00000339839 ; MAP4K4-001; intron 3
OTTHUMT00000339994 ; MAP4K4-005; intron 3
OTTHUMT00000339997 ; MAP4K4-008; intron 4
ENST00000496989 ; MAP4K4-009; intron 1
ENST00000350878 ; MAP4K4-204; intron 1
ENST00000417294 ; MAP4K4-004; intron 2
ENST00000425019 ; MAP4K4-002; intron 3
ENST00000413150 ; MAP4K4-003; intron 3
ENST00000347699 ; MAP4K4-001; intron 3
ENST00000456652 ; MAP4K4-005; intron 3
ENST00000324219 ; MAP4K4-202; intron 3
ENST00000350198 ; MAP4K4-203; intron 3
ENST00000302217 ; MAP4K4-201; intron 3
ENST00000427603 ; MAP4K4-008; intron 4
Database links

Mature sequence hsa-miR-4772-5p

Accession MIMAT0019926
Sequence

12 - 

ugaucaggcaaaauugcagacu

 - 33

Get sequence
Deep sequencing93 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4772-3p

Accession MIMAT0019927
Sequence

48 - 

ccugcaacuuugccugaucaga

 - 69

Get sequence
Deep sequencing99 reads, 39 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).