Stem-loop sequence hsa-mir-4769

AccessionMI0017410 (change log)
Symbol HGNC:MIR4769
DescriptionHomo sapiens miR-4769 stem-loop
Literature search

1 open access papers mention hsa-mir-4769
(1 sentences)

Stem-loop
   ga        --    u    a  a    u     aaaa 
5'   ggagaggu  ggga ggag ga ggua gagcu    a
     ||||||||  |||| |||| || |||| |||||    u
3'   ccucuuca  cccu ccuc cu ccgu cucga    c
   cc        uc    c    -  a    -     accc 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 47587429-47587505 [+]
sense
OTTHUMT00000450074 ; CXorf25-003; intron 1
OTTHUMT00000056433 ; CXorf25-001; intron 3
ENST00000589302 ; CXXC1P1-003; intron 1
ENST00000483225 ; CXXC1P1-001; intron 3
Database links

Mature sequence hsa-miR-4769-5p

Accession MIMAT0019922
Sequence

8 - 

ggugggauggagagaagguaugag

 - 31

Get sequence
Deep sequencing23 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4769-3p

Accession MIMAT0019923
Sequence

48 - 

ucugccauccucccuccccuac

 - 69

Get sequence
Deep sequencing36 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).