Stem-loop sequence hsa-mir-4768

AccessionMI0017409 (change log)
Symbol HGNC:MIR4768
DescriptionHomo sapiens miR-4768 stem-loop
Stem-loop
                         -  a       g ga 
5' aaacuuugauucucucuggauc cc uggauau g  a
   |||||||||||||||||||||| || ||||||| |   
3' uuugagacuaagagagaccuag gg accugua u  c
                         a  -       g gu 
Get sequence
Deep sequencing
95 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 17425881-17425954 [+]
sense
OTTHUMT00000059120 ; NHS-001; intron 1
ENST00000380060 ; NHS-001; intron 1
Database links

Mature sequence hsa-miR-4768-5p

Accession MIMAT0019920
Sequence

9 - 

auucucucuggaucccauggau

 - 30

Get sequence
Deep sequencing77 reads, 40 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4768-3p

Accession MIMAT0019921
Sequence

47 - 

ccaggagauccagagagaau

 - 66

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).