Stem-loop sequence hsa-mir-4767

AccessionMI0017408 (change log)
Symbol HGNC:MIR4767
DescriptionHomo sapiens miR-4767 stem-loop
Literature search

3 open access papers mention hsa-mir-4767
(48 sentences)

Stem-loop
   --aca     --     g  ---         c c g    a 
5'      ugggc  ccgcg gc   gcuccuggc g c cccg c
        |||||  ||||| ||   ||||||||| | | ||||  
3'      gcccg  ggcgc cg   cgggggccg c g gggc u
   ugcga     ag     g  aga         a c -    u 
Get sequence
Deep sequencing
111 reads, 2 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 7147860-7147937 [+]
sense
OTTHUMT00000055686 ; STS-001; intron 1
ENST00000217961 ; STS-001; intron 1
Database links

Mature sequence hsa-miR-4767

Accession MIMAT0019919
Sequence

10 - 

cgcgggcgcuccuggccgccgcc

 - 32

Get sequence
Deep sequencing81 reads, 32 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).