Stem-loop sequence hsa-mir-4766

AccessionMI0017407 (change log)
Symbol HGNC:MIR4766
DescriptionHomo sapiens miR-4766 stem-loop
Gene family MIPF0001764; mir-4766
Literature search

1 open access papers mention hsa-mir-4766
(44 sentences)

Stem-loop
     g   c      ug            g      uuu 
5' cu aag uccuuc  aaagagcaguug uguuua   u
   || ||| ||||||  |||||||||||| ||||||    
3' ga uuc aggaag  uuucucguuaac auaaau   u
     g   a      gu            g      cau 
Get sequence
Deep sequencing
569 reads, 1.49 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 40813883-40813958 [-]
sense
OTTHUMT00000321524 ; MKL1-003; intron 9
OTTHUMT00000321523 ; MKL1-002; intron 11
OTTHUMT00000321522 ; MKL1-001; intron 12
ENST00000407029 ; MKL1-003; intron 9
ENST00000402042 ; MKL1-002; intron 11
ENST00000355630 ; MKL1-001; intron 12
ENST00000396617 ; MKL1-201; intron 12
Database links

Mature sequence hsa-miR-4766-5p

Accession MIMAT0019917
Sequence

12 - 

ucugaaagagcaguugguguu

 - 32

Get sequence
Deep sequencing115 reads, 41 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4766-3p

Accession MIMAT0019918
Sequence

46 - 

auagcaauugcucuuuuggaa

 - 66

Get sequence
Deep sequencing445 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).