Stem-loop sequence hsa-mir-4765

AccessionMI0017406 (change log)
Symbol HGNC:MIR4765
DescriptionHomo sapiens miR-4765 stem-loop
Stem-loop
   u                      cac        c g 
5'  ggugauuuugaacguagcuauc   cacucagc u g
    ||||||||||||||||||||||   |||||||| | a
3'  ccacuaaaacuuguaucgauag   gugagucg a a
   a                      uua        a a 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 32635255-32635331 [+]
sense
OTTHUMT00000318769 ; BIRC6-001; intron 9
ENST00000421745 ; BIRC6-001; intron 9
Database links

Mature sequence hsa-miR-4765

Accession MIMAT0019916
Sequence

46 - 

ugagugauugauagcuauguuc

 - 67

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).