Stem-loop sequence hsa-mir-4764

AccessionMI0017405 (change log)
Symbol HGNC:MIR4764
DescriptionHomo sapiens miR-4764 stem-loop
Literature search

1 open access papers mention hsa-mir-4764
(1 sentences)

Stem-loop
               a              u   u acca u   a 
5' ucuuccccaugg uguggaaggaguua cug c    g cag u
   |||||||||||| |||||||||||||| ||| |    | |||  
3' agaagggguacc acacuuuccucaau gac g    c guc a
               c              u   u acca u   a 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 33436582-33436669 [-]
sense
OTTHUMT00000075892 ; SYN3-001; intron 1
OTTHUMT00000268513 ; SYN3-009; intron 1
ENST00000358763 ; SYN3-001; intron 1
ENST00000441821 ; SYN3-009; intron 1
Database links

Mature sequence hsa-miR-4764-5p

Accession MIMAT0019914
Sequence

10 - 

uggauguggaaggaguuaucu

 - 30

Get sequence
Deep sequencing29 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4764-3p

Accession MIMAT0019915
Sequence

61 - 

uuaacuccuuucacacccaugg

 - 82

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).