Stem-loop sequence hsa-mir-4763

AccessionMI0017404 (change log)
Symbol HGNC:MIR4763
DescriptionHomo sapiens miR-4763 stem-loop
Literature search

6 open access papers mention hsa-mir-4763
(11 sentences)

Stem-loop
         -          u     u    agcccuc    u      acu 
5' ccuguc ccuccugccc gcgcc gccc       cugc cuggug   g
   |||||| |||||||||| ||||| ||||       |||| ||||||   a
3' gggcgg ggggggcggg cgugg cggg       gacg gaccgc   g
         c          u     u    -------    -      cag 
Get sequence
Deep sequencing
268 reads, 5.33 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 46113566-46113657 [+]
sense
OTTHUMT00000322280 ; ATXN10-004; intron 1
OTTHUMT00000318142 ; ATXN10-001; intron 5
OTTHUMT00000322278 ; ATXN10-002; intron 5
ENST00000476998 ; ATXN10-004; intron 1
ENST00000381061 ; ATXN10-201; intron 4
ENST00000252934 ; ATXN10-001; intron 5
ENST00000498009 ; ATXN10-002; intron 5
Clustered miRNAs
< 10kb from hsa-mir-4763
hsa-let-7a-3chr22: 46112749-46112822 [+]
hsa-mir-4763chr22: 46113566-46113657 [+]
hsa-let-7bchr22: 46113686-46113768 [+]
Database links

Mature sequence hsa-miR-4763-5p

Accession MIMAT0019912
Sequence

19 - 

cgccugcccagcccuccugcu

 - 39

Get sequence
Deep sequencing40 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4763-3p

Accession MIMAT0019913
Sequence

59 - 

aggcaggggcuggugcugggcggg

 - 82

Get sequence
Deep sequencing117 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).