Stem-loop sequence hsa-mir-4762

AccessionMI0017403 (change log)
Symbol HGNC:MIR4762
DescriptionHomo sapiens miR-4762 stem-loop
Literature search

2 open access papers mention hsa-mir-4762
(2 sentences)

Stem-loop
   -c       c                     gaucag 
5'   ugauacc caaaucuugaucagaagccuu      a
     ||||||| |||||||||||||||||||||       
3'   acugugg guuuagaacuagucuucggaa      a
   ga       u                     ggaucg 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 45760524-45760598 [+]
antisense
OTTHUMT00000322256 ; SMC1B-003; intron 15
OTTHUMT00000322255 ; SMC1B-002; intron 15
ENST00000357450 ; SMC1B-003; intron 15
ENST00000404354 ; SMC1B-002; intron 15
Database links

Mature sequence hsa-miR-4762-5p

Accession MIMAT0019910
Sequence

9 - 

ccaaaucuugaucagaagccu

 - 29

Get sequence
Deep sequencing123 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4762-3p

Accession MIMAT0019911
Sequence

49 - 

cuucugaucaagauuuguggug

 - 70

Get sequence
Deep sequencing76 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).