Stem-loop sequence hsa-mir-4760

AccessionMI0017401 (change log)
Symbol HGNC:MIR4760
DescriptionHomo sapiens miR-4760 stem-loop
Literature search

2 open access papers mention hsa-mir-4760
(2 sentences)

Stem-loop
          u                  g    aauucuua 
5' gccaugg guuuagauugaacaugaa uuag        a
   ||||||| |||||||||||||||||| ||||         
3' cgguacc caaaucuaacuuguacuu aauc        g
          c                  a    aaaacuau 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 40212352-40212431 [-]
intergenic
Database links

Mature sequence hsa-miR-4760-5p

Accession MIMAT0019906
Sequence

10 - 

uuuagauugaacaugaaguuag

 - 31

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4760-3p

Accession MIMAT0019907
Sequence

52 - 

aaauucauguucaaucuaaacc

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).