Stem-loop sequence hsa-mir-4759

AccessionMI0017400 (change log)
Symbol HGNC:MIR4759
DescriptionHomo sapiens miR-4759 stem-loop
Literature search

1 open access papers mention hsa-mir-4759
(1 sentences)

Stem-loop
                                g  aaaaguua 
5' cauuuaggacuagauguuggaauuagaca aa        g
   ||||||||||||||||||||||||||||| ||        a
3' guaaauccugaucuacaaccuuaaucugu uu        c
                                g  aaaaaaca 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 26953961-26954043 [+]
intergenic
Database links

Mature sequence hsa-miR-4759

Accession MIMAT0019905
Sequence

5 - 

uaggacuagauguuggaauua

 - 25

Get sequence
Deep sequencing15 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).