Stem-loop sequence hsa-mir-4757

AccessionMI0017398 (change log)
Symbol HGNC:MIR4757
DescriptionHomo sapiens miR-4757 stem-loop
Stem-loop
   -uucc   c                   c   g   gc 
5'      agc cgaggccucugugacguca ggu ucu  g
        ||| ||||||||||||||||||| ||| |||   
3'      ucg gcuucggagacacugcagu cca agg  g
   gaguc   c                   a   g   ag 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 19348429-19348505 [+]
antisense
OTTHUMT00000323832 ; AC092594.1-002; intron 1
OTTHUMT00000323837 ; AC092594.1-004; intron 1
OTTHUMT00000323836 ; AC092594.1-003; intron 1
ENST00000432142 ; AC092594.1-002; intron 1
ENST00000418165 ; AC092594.1-004; intron 1
ENST00000449124 ; AC092594.1-003; intron 1
Database links

Mature sequence hsa-miR-4757-5p

Accession MIMAT0019901
Sequence

11 - 

aggccucugugacgucacggugu

 - 33

Get sequence
Deep sequencing50 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4757-3p

Accession MIMAT0019902
Sequence

48 - 

caugacgucacagaggcuucgc

 - 69

Get sequence
Deep sequencing52 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).