Stem-loop sequence hsa-mir-4756

AccessionMI0017397 (change log)
Symbol HGNC:MIR4756
DescriptionHomo sapiens miR-4756 stem-loop
Stem-loop
     g        c         cu  c      c   cg 
5' gg auaaaaug agggaggcg  ca ucucug ugc  a
   || |||||||| |||||||||  || |||||| |||  u
3' cu uguuuuau uccuuccgu  gu agagac acg  u
     g        a         ug  -      c   uc 
Get sequence
Deep sequencing
44 reads, 11.1 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 54068408-54068485 [-]
antisense
OTTHUMT00000259285 ; RP5-1010E17.1-002; intron 5
ENST00000416190 ; RP5-1010E17.1-002; intron 5
Database links

Mature sequence hsa-miR-4756-5p

Accession MIMAT0019899
Sequence

12 - 

cagggaggcgcucacucucugcu

 - 34

Get sequence
Deep sequencing24 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4756-3p

Accession MIMAT0019900
Sequence

47 - 

ccagagaugguugccuuccuau

 - 68

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).