Stem-loop sequence hsa-mir-4755

AccessionMI0017395 (change log)
Symbol HGNC:MIR4755
DescriptionHomo sapiens miR-4755 stem-loop
Literature search

1 open access papers mention hsa-mir-4755
(1 sentences)

Stem-loop
                                  g ca 
5' agauucagcuuucccuucagagccuggcuuu g  u
   ||||||||||||||||||||||||||||||| |   
3' ucuaaguugaaagggaagucucggaccgaaa u  c
                                  g au 
Get sequence
Deep sequencing
359 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 34049119-34049190 [+]
sense
OTTHUMT00000354652 ; CEP250-013; intron 2
OTTHUMT00000125974 ; CEP250-002; intron 3
OTTHUMT00000125975 ; CEP250-003; intron 3
OTTHUMT00000315969 ; CEP250-007; intron 3
OTTHUMT00000078877 ; CEP250-001; intron 3
OTTHUMT00000156149 ; CEP250-006; intron 3
ENST00000461386 ; CEP250-013; intron 2
ENST00000446710 ; CEP250-002; intron 3
ENST00000420564 ; CEP250-003; intron 3
ENST00000476146 ; CEP250-007; intron 3
ENST00000397527 ; CEP250-001; intron 3
ENST00000397524 ; CEP250-006; intron 3
ENST00000342580 ; CEP250-201; intron 3
Database links

Mature sequence hsa-miR-4755-5p

Accession MIMAT0019895
Sequence

10 - 

uuucccuucagagccuggcuuu

 - 31

Get sequence
Deep sequencing67 reads, 29 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4755-3p

Accession MIMAT0019896
Sequence

44 - 

agccaggcucugaagggaaagu

 - 65

Get sequence
Deep sequencing64 reads, 37 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).