Stem-loop sequence hsa-mir-4754

AccessionMI0017394 (change log)
Symbol HGNC:MIR4754
DescriptionHomo sapiens miR-4754 stem-loop
Stem-loop
   ac    c  -au    --      gu a      uga   cca      
5'   gcgc ug   gcgg  accugg  u gcggag   ggc   guggu 
     |||| ||   ||||  ||||||  | ||||||   |||   |||| c
3'   cgug ac   ugcc  uggacc  g cgccuc   ccg   cgcca 
   uc    u  gcg    gu      ug a      ---   --c      
Get sequence
Deep sequencing
39 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 58386770-58386858 [-]
sense
OTTHUMT00000466969 ; ZNF814-008; intron 1
OTTHUMT00000466965 ; ZNF814-014; intron 2
OTTHUMT00000466967 ; ZNF814-010; intron 2
OTTHUMT00000466968 ; ZNF814-007; intron 2
OTTHUMT00000466971 ; ZNF814-004; intron 2
OTTHUMT00000466972 ; ZNF814-006; intron 2
OTTHUMT00000466973 ; ZNF814-012; intron 2
OTTHUMT00000466974 ; ZNF814-005; intron 2
OTTHUMT00000466976 ; ZNF814-001; intron 2
OTTHUMT00000466966 ; ZNF814-002; intron 3
ENST00000595295 ; ZNF814-008; intron 1
ENST00000596604 ; ZNF814-014; intron 2
ENST00000597832 ; ZNF814-010; intron 2
ENST00000595894 ; ZNF814-007; intron 2
ENST00000597348 ; ZNF814-004; intron 2
ENST00000600634 ; ZNF814-006; intron 2
ENST00000595048 ; ZNF814-012; intron 2
ENST00000594629 ; ZNF814-005; intron 2
ENST00000435989 ; ZNF814-001; intron 2
ENST00000597342 ; ZNF814-002; intron 3
Clustered miRNAs
< 10kb from hsa-mir-4754
hsa-mir-10394chr19: 58393364-58393446 [+]
hsa-mir-4754chr19: 58386770-58386858 [-]
Database links

Mature sequence hsa-miR-4754

Accession MIMAT0019894
Sequence

10 - 

augcggaccuggguuagcggagu

 - 32

Get sequence
Deep sequencing34 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).