Stem-loop sequence hsa-mir-4752

AccessionMI0017391 (change log)
Symbol HGNC:MIR4752
DescriptionHomo sapiens miR-4752 stem-loop
Stem-loop
                gg    c           u ca 
5' agugucuccuugu  aucu aaggaugugcu c  c
   |||||||||||||  |||| ||||||||||| |   
3' ucacagaggaaca  uaga uucuuguacga g  a
                gg    c           c au 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 54282109-54282180 [+]
intergenic
Database links

Mature sequence hsa-miR-4752

Accession MIMAT0019889
Sequence

10 - 

uuguggaucucaaggaugugcu

 - 31

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).