Stem-loop sequence hsa-mir-4749

AccessionMI0017388 (change log)
Symbol HGNC:MIR4749
DescriptionHomo sapiens miR-4749 stem-loop
Stem-loop
   c   c    a    cca    a  uag    u 
5'  cug gggg cagg   gggc uc   gcug g
    ||| |||| ||||   |||| ||   ||||  
3'  gac cccc gucc   cccg ag   ugac c
   -   a    c    -uc    c  ---    a 
Get sequence
Deep sequencing
157 reads, 9.26 reads per million, 54 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49854591-49854651 [+]
antisense
OTTHUMT00000465498 ; TEAD2-009; intron 3
OTTHUMT00000465499 ; TEAD2-007; exon 4
OTTHUMT00000465466 ; TEAD2-002; exon 6
OTTHUMT00000465500 ; TEAD2-010; exon 6
OTTHUMT00000465464 ; TEAD2-003; exon 7
OTTHUMT00000465465 ; TEAD2-001; exon 7
OTTHUMT00000465467 ; TEAD2-004; exon 7
OTTHUMT00000465462 ; TEAD2-006; exon 8
OTTHUMT00000465463 ; TEAD2-005; exon 8
ENST00000598823 ; TEAD2-009; intron 3
ENST00000598397 ; TEAD2-007; exon 4
ENST00000377214 ; TEAD2-002; exon 6
ENST00000596757 ; TEAD2-010; exon 6
ENST00000601519 ; TEAD2-003; exon 7
ENST00000311227 ; TEAD2-001; exon 7
ENST00000539846 ; TEAD2-004; exon 7
ENST00000598810 ; TEAD2-006; exon 8
ENST00000593945 ; TEAD2-005; exon 8
Database links

Mature sequence hsa-miR-4749-5p

Accession MIMAT0019885
Sequence

3 - 

ugcggggacaggccagggcauc

 - 24

Get sequence
Deep sequencing114 reads, 43 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4749-3p

Accession MIMAT0019886
Sequence

42 - 

cgccccuccugcccccacag

 - 61

Get sequence
Deep sequencing40 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).