Stem-loop sequence hsa-mir-4746

AccessionMI0017385 (change log)
Symbol HGNC:MIR4746
DescriptionHomo sapiens miR-4746 stem-loop
Literature search

2 open access papers mention hsa-mir-4746
(10 sentences)

Stem-loop
      ucu   c      -      a   u  aga   a 
5' gug   gug cggucc caggag acc gc   ggc u
   |||   ||| |||||| |||||| ||| ||   ||| c
3' cac   cac gccggg guccuc ugg cg   cug g
      --u   a      c      g   -  --a   g 
Get sequence
Deep sequencing
513 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 4445978-4446048 [+]
sense
ENST00000579802 ; MIR4746-201; exon 1
antisense
OTTHUMT00000458448 ; UBXN6-005; exon 1
OTTHUMT00000458635 ; UBXN6-006; intron 2
OTTHUMT00000458636 ; UBXN6-009; intron 2
OTTHUMT00000458449 ; UBXN6-004; intron 3
OTTHUMT00000458446 ; UBXN6-003; intron 8
OTTHUMT00000458447 ; UBXN6-002; intron 10
OTTHUMT00000458450 ; UBXN6-001; intron 10
ENST00000588238 ; UBXN6-005; exon 1
ENST00000590466 ; UBXN6-006; intron 2
ENST00000587324 ; UBXN6-009; intron 2
ENST00000587009 ; UBXN6-004; intron 3
ENST00000591919 ; UBXN6-003; intron 8
ENST00000301281 ; UBXN6-002; intron 10
ENST00000394765 ; UBXN6-001; intron 10
Database links

Mature sequence hsa-miR-4746-5p

Accession MIMAT0019880
Sequence

10 - 

ccggucccaggagaaccugcaga

 - 32

Get sequence
Deep sequencing468 reads, 55 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4746-3p

Accession MIMAT0019881
Sequence

44 - 

agcggugcuccugcgggccga

 - 64

Get sequence
Deep sequencing45 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).